l’amore al tempo del paleolitico

[Illustrazione di © Emmanuel Roudier, dal libro Vo’hounâ]

[Illustrazione di © Emmanuel Roudier, dal libro Vo’hounâ, Une légende préhistorique]

Tra le cose che mi porto dietro fin da ragazzino e che durano ancora ci sono la passione per il mondo prima della storia e la lettura dei fumetti. Le prove sono la testata del blog (omaggio anche alla Sci-Fi), le illustrazioni che accompagnano i post, gli storici albi Marvel gelosamente conservati e alcune letture che non ho mai abbandonato: ad esempio tra i libri impilati in attesa di essere letti c’è I Signori del Pianeta, un bel libro di   antropologo di fama mondiale, dove si racconta del lungo cammino fatto dall’Homo Sapiens e di come sia arrivato ad essere “l’unica specie umana sopravvissuta” tra le tante che coesistevano. E se sarà tradotto in italiano  aggiungerò di sicuro “Vo’hounâ, Une légende préhistorique” che ho scoperto leggendo questo post di Anna Meldolesi.

La Graphic Novel (ora si dice così per Fumetto da Collezione, no?) è disegnata da Emmanuel Roudier, disegnatore francese che da quello che ho potuto vedere dal suo blog ha un tratto classico e che da profano mi sembra uno stile tipo Lanciostory (ma qui potrà soccorrermi la Fumettista Curiosa, disegnatrice di Nathan Never) che ad un certo punto privilegiò disegnatori della scuola franco-belga. Ma torniamo a Roudier che ho scoperto essere autore di altri albi ambientati nella preistoria: Neandertal, la Guerra del Fuoco (che fu pure uno dei rari film ambientati in quest’epoca lontana).

Il libro non solo è un piacevole passatempo, ma presenta un aspetto interessante che si lega con le più recenti e discusse scoperte in fatto di paleoantropologia, infatti si racconta dell’amore tra il sapiens Cheval-Cabré e la neandertaliana Vo’hounâ e dalla loro unione nasceranno due figli che saranno dunque un ibrido tra le due specie. Ma un incrocio tra queste due specie era possibile?

Secondo le scoperte del professor Clive Finlayson è probabile. L’uomo di Neanderthal e l’homo sapiens hanno convissuto almeno per 4000 anni nell’Europa meridionale come riportato su Nature dell’ottobre del 2006, quindi per il doppio del tempo dalla datazione del nostro tempo dopo Cristo. Non volete che in tutto questo tempo qualcuno non abbia provato curiosità o attrazione per l’altro?

Le ipotesi fino a qualche anno fa erano orientate ad escludere il mescolamento. Al Max Planck Institute iniziarono a sequenziare nel 1997 poco più di un centinaio di elementi base dai brandelli di Dna e nel 2010 dedussero che il cromosoma Y fosse molto diverso da quello dei Sapiens. Lasciando aperta la domanda su chi fossero, da dove venissero e perché si estinsero i Neanderthal. Sono un ramo anomalo dell’evoluzione umana oppure lo siamo noi discendenti? Si estinsero per mutamenti climatici, malattie epidemiche o perchè meno evoluti?

Nel 2010 il team di scienziati guidati da Svante Pääbo “archeologo del genoma” e direttore del laboratorio di antropologia dell’evoluzione al Max Planck Institute proseguì il sequenziamento grazie ad altri ritrovamenti nel Caucaso e in Croazia e grazie anche ai nuovi metodi di biologia molecolare, individua similitudini tra il 60% del genoma ricostruito con il 1% – 4% di quello di un cinese, un francese e un papuano, mentre nessuna similitudine era presente nel genoma dei due africani che completavano il gruppo. Perché? Secondo Pääbo gli uomini moderni lasciando l’Africa incontrarono i loro cugini in Europa e in Medio Oriente, per questo sono assenti similarità nei due africani. A questo punto l’incrocio tra le due specie è più di una semplice ipotesi.

Svante Pääbo crede che, quando gli uomini umani hanno lasciato l'Africa per la prima volta, siano passati dal Medio Oriente, si siano riprodotti con i Neanderthal e abbiano poi colonizzato il resto del mondo. Portando con loro sequenze del DNA dei Neanderthal [elaborazione di Nicola Graf via Science in School]

Svante Pääbo crede che, quando gli uomini umani hanno lasciato l’Africa per la prima volta, siano passati dal Medio Oriente, si siano riprodotti con i Neanderthal e abbiano poi colonizzato il resto del mondo. Portando con loro sequenze del DNA dei Neanderthal [elaborazione di Nicola Graf via Science in School]

La tecnica utilizzata è quella della bioinformatica degli allineamenti di sequenza dei nucleotidi. In pratica le mutazioni del Dna si verificano in modo casuale nei lunghi periodi, quindi si valutano le differenze intercorse nelle sequenza omologhe (cioè sufficientemente simili) per valutare il tempo che ci hanno messo gli organismi per divergere: ad esempio gli uccelli e i rettili hanno iniziato a separarsi 220 milioni di anni fa circa e presentano sequenze di Dna molto differenti. E confrontando le stringhe dei Neanderthal e degli esseri umani si hanno tre differenze dei nucleotidi.

Neanderthal TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
Human TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC

Il numero delle differenze nucleotidiche tra le due sequenze viene diviso per il numero totale di nucleotidi di ogni sequenza che ci dà la distanza proporzionale tra le due sequenze. Quindi le 3 differenze nelle 46 sequenze è o,o65 (è un esempio sulla filogenetica e non una dimostrazione rigorosa). Comunque dopo una serie di passaggi costruiti con appositi algoritmi si arriva alla costruzione dell’albero filogenetico che in questo caso si avvicina a questo qui sotto:

Esempio di albero filogenetico incompleto [Immagine gentilmente concessa da Nicola Graf via Science in School]

Esempio di albero filogenetico incompleto [Immagine gentilmente concessa da Nicola Graf via Science in School]

Dunque la storia d’amore tra il sapiens Cheval-Cabré e la neandertaliana Vo’hounâ è solo una lunga sequenza genomica? E il fumetto davvero tiene conto di tutto questo? Sì. Non solo. L’autore infatti sembra essersi ispirato alle recenti ricerche condotte da alcuni ricercatori, infatti leggo che la prole generata nella storia presenta un mento osseo ibrido: assente nell’uomo di Neanderthal classico e sviluppato negli uomini moderni. La ricerca cui si fa riferimento è stata pubblicata su PLoS ONE e ha per oggetto la mandibola del cosiddetto uomo dai capelli rossi, i cui resti scheletrici sono stati scoperti nel 1957 a Riparo Mezzena sui Monti Lessini vicino Verona, che presenta un accenno di mento osseo. Ricostruita in 3D è stata confrontata con quella di un Homo Sapiens e l’analisi genetica del Dna mitocondriale, che si trasmettono dalla madre al figlio, ha stabilito che la madre era una  neandertaliana, proprio come l’eroina della storia e che la mandibola presenta una struttura ibrida.

Come per ogni scoperta si aspettano riscontri ulteriori, ma la scoperta potrebbe rappresentare una svolta nella storia della nostra evoluzione. Sicuramente non avremo tutte le risposte riguardo la rapida estinzione di Neanderthal e Silvana Condemi, antropologa del team di ricercatori sostiene che se confermata allora non è da scartare la teoria che l’effetto delle migrazioni dei Sapiens abbiano   progressivamente sostituito i Neanderthal: una coabitazione parallela dove -forse- la superiorità tecnica dei Sapiens dovuta alla capacità simbolica (ad esempio il linguaggio che favorisce relazioni sociali e organizzazione, tesi sostenuta tra l’altro da Ian Tattersall nel libro citato all’inizio) che i Neanderthal hanno subìto assimilandosi. Competizione tra i gruppi, risorse e aree limitate per il clima glaciale (le prealpi venete godono di una esposizione al sole per molte ore della giornata) hanno -forse- concorso nell’insieme facendo prevalere i nostri antichi parenti, sebbene portiamo con noi un piccolissimo percento degli altri inspiegabilmente estinti.

Curiosità: l’uomo dai capelli rossi i cui resti furono scoperti nel 1957 fu utilizzato nella ricerca del 2007 da un team composto da ricercatori tedeschi (vedi sopra), spagnoli e italiani; il coordinatore del gruppo italico era David Caramelli, antropologo molecolare dell’Università di Firenze, Lo studio era questo.

LE FONTI:

Homo symbolicus. Ecco il momento esatto in cui siamo diventati umani. di Ian Tattersall 

Le conquiste dell’Homo Sapiens. di Ian Tattersall intervista di: Pietro Greco

La ricerca su Plos One di cui si parla: Possible Interbreeding in Late Italian Neanderthals? New Data from the Mezzena Jaw

Lavori di David Caramelli sono reperibili QUI e QUI, e una bella intervista uscita su Toscana Oggi: DAVID CARAMELLI: lo scienziato che ha dato un volto all’uomo di Neanderthal

per la Bioinformatica: Bioinformatics with pen and paper: building a phylogenetic tree

Svante Pääbo, archeologo del genoma

Il post che mi ha ispirato: Love Story di Anna Meldolesi credo una “rilettura” di questo (senza citare)

PS: potevo scriverlo meglio questo post? Ovviamente sì, almeno in dieci modi diversi e cercherò di fare sempre meglio.

2 pensieri su “l’amore al tempo del paleolitico

  1. L’articolo della Meldolesi l’avevo letto stamattina e notando il tuo post ho pensato: “Toh!, anche qui si parla del fumetto francese che…” – e insomma, vedo che sono citata, allora intervengo (anche per sottolineare l’argomento interessantissimo che affronti e farti i complimenti per la chiarezza espositiva): non conosco l’autore francese di questo fumetto, ma da quel che vedo mi sembra bravo e della classica scuola realistica d’Oltralpe (che in parte Lanciostory ospita, sì, ma non esclusivamente). In Francia sono molti i disegnatori capaci di disegnare con competenza e freschezza di tratto storie di ambientazione storica, di solito ben documentate, e non mi meraviglia che sia così anche per il fumetto in questione (anche se mi sembra che la Meldolesi abbia scritto che l’ibridazione dovrebbe essere avvenuta tra donne umane e uomini Neanderthal).

  2. Ciao Patrizia. Grazie per i complimenti anche se mi sembrava di essere stato un poco farraginoso in alcuni punti. Sì, mi piacciono i disegnatori francesi ma soprattutto quelli che si rifanno allo stile “tradizionale” della ligne claire (i disegni alla Tin Tin tanto per farmi capire) che ritrovo anche in alcuni cartoni animati che sono arrivati fin qui e i tratti comunque luminosi. Mentre il disegno ricco di particolari, chiaro-scuri e dettagli lo preferisco nei sudamericani (Eternauta docet, ma anche Munoz e Sampayo). Poi trovo interessante questa attenzione che mi sembra davvero caratteristica dei francesi per i fumetti storici.
    Ah! Dimenticavo. Hai ragione sull’appunto che la Meldolesi ricorda: lo scambio tra donne Sapiens e uomini Neanderthal, l’avevo scritto in bozza e poi l’ho perso nella riscrittura.
    A presto e grazie per il commento puntuale e competente.

Lascia un commento

Inserisci i tuoi dati qui sotto o clicca su un'icona per effettuare l'accesso:

Logo WordPress.com

Stai commentando usando il tuo account WordPress.com. Chiudi sessione / Modifica )

Foto Twitter

Stai commentando usando il tuo account Twitter. Chiudi sessione / Modifica )

Foto di Facebook

Stai commentando usando il tuo account Facebook. Chiudi sessione / Modifica )

Google+ photo

Stai commentando usando il tuo account Google+. Chiudi sessione / Modifica )

Connessione a %s...